• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The present invention discloses an SNP molecular marker for 'ester-type flavor' trait 5 identification of apple fruits as well as primers and applications thereof. The molecular marker is of an A<—>G transformation type. According to the molecular marker, amplification primers and SNP gene chips are developed, thereby realizing early identification of traits of ester-type volatile components of apple fruits. By virtue of the SNP molecular marker and the SNP gene chips in the present invention, rapid and 10 accurate identification of content of the ester-type volatile components of apples can be realized, and breeding time of hybrid apple seedlings and economic cost are reduced. The present invention provides marker resources for molecular marker assisted breeding of apple flavor quality, lays a foundation for innovating high-quality new germplasm by utilizing genetic engineering means and has important theoretical significance and actual 15 application values.
    公开号:NL2025233A
    申请号:NL2025233
    申请日:2020-03-30
    公开日:2020-12-03
    发明作者:Wang Haibo；Chang Yuansheng；He Ping；Wang Sen；He Xiaowen；Wang Chuanzeng；Sun Jizheng；Li Huifeng；Li Linguang
    申请人:Shandong Inst Pomology；
    IPC主号:
    专利说明:

    SNP MOLECULAR MARKER FOR 'ESTER-TYPE FLAVOUR' TRAIT IDENTIFICATION
    OF APPLE FRUITS AS WELL AS PRIMERS AND APPLICATIONS THEREOF Technical Field The present invention relates to an SNP (single nucleotide polymorphism) molecular marker for 'ester-type flavour trait identification of apple fruits and primers of the SNP molecular marker, further relates to an SNP chip and a method for rapidly identifying 'ester-type flavour’ of apple fruits, and belongs to the technical field of crop genetics and breeding. Background Fruit quality improvement is the theme of apple breeding in the world, and a primary goal of breeding new varieties is to achieve excellent fruit quality. The composition of fruit quality mainly includes fruit surface appearance, fruit flavour, fruit texture, nutritional ingredients, and the like, wherein the fruit flavour is composed of sweet and sour flavour and sense of smell, while strong sense of smell of fruits and good fruit appearance are direct factors that determine the purchase of fruits by consumers. Components determining the sense of smell of mature apple fruits are very complicated and include about 350 volatile components. Flavouring component in the volatile components are mainly low molecular esters, such as acetate, propionate, butyrate, hexanoate, butanol esters, pentanol esters and hexanol esters, as well as a few of alcohol, aldehyde and terpene compounds (Dixon and Hewett, 2000; Song and Forney, 2008). In long-term evolution and artificial selection processes, types and contents of volatile smell components of different varieties of fruits have obvious genotype differences. For example, fruits of varieties having strong fruity flavour, such as 'Delicious', 'Gala’, 'Fuji’ and 'Golden Delicious’, have high content of ester components including 2-methylbutyl acetate, butyl acetate, 2-methylbutyl acetate, pentyl acetate, hexyl acetate, ethyl butyrate and ethyl hexanoate, and have typical 'ester-type flavour’ or ‘fruity flavour’. However, ‘Granny Smith’, 'Ralls' and the like have high content of alcohol and aldehyde components such as 2-methyl-1-butanol, 1-hexanol, hexanal and (E)-2-hexenal, and the fruits have strong 'grass-like aroma’ and slight ‘fruity flavour’ (Matich et al., 1996, Mehinagic et al., 2006, Rowan et al., 2009). Fruits of apples generally include various linear or branched ester-type volatile components, wherein the linear ester type components are derived from a fatty acid metabolism process of lipoxygenase catalysis, while the branched ester type components are synthesized by taking isoleucine as a precursor (Rowan et al, 1996). The last reaction step of synthesis of the ester components {acyl group provided by coenzyme A is transferred to an alcohol receptor) is catalysed by alcohol acyltransferase, while ethanol dehydrogenase is the key enzyme of metabolism of the alcohol and aldehyde components in the fruits. Coding genes of the enzymes are key genes of regulating the types and content of the volatile components of the apple fruits. Differences of the sense of smell among apple fruit varieties, that is, differences of volatile smell components, are determined by genotypes, and such a trait provides the possibility for a trait of improving flavour quality of the fruits by virtue of a genetic method. In the conventional breeding, evaluation for traits of hybrid progeny fruits can only be performed after large-scale fruiting of progeny, while the direct evaluation workload on progeny fruit quality is huge, which goes against targeted breeding of varieties with 'ester- type flavour fresh in line with consumer preferences. Moreover, since the apple, a perennial woody crop, has a long juvenile phase (generally 3-7 years), and is large in individual size, wide in land occupancy and power- and labour-consuming in management, problems such as too long period and too high cost may exist in breeding work. However, the hybrid progenies can be screened earlier by virtue of an appropriate molecular marker; individuals having no objective trait are eliminated in advance, while individuals meeting the breeding objective are retained. Such a molecular marker assisted technology can effectively increase breeding efficiency, and development of a linked molecular marker is the precondition of the work.
    At present, with development of plant genome sequencing, a quantitative trait locus research technique based on genetic maps is in the ascendant and provides a new research approach for analysing and developing a molecular marker behind the key phenotype. In early molecular marker selection study of fruit quality traits of apples, Longhi et al. (2013) identified affinity between MdPG1SSR10kd and fruit texture, and the MdPG1SSR10kd was considered as a molecular marker having great potential for fruit texture assisted selection. Ma et al. (2016) identified two SNPs related to malic acid by virtue of genetic mapping of malic acid related QTLs, and the SNPs may serve as candidate loci of malic acid assisted selection. Sun et al. (2014) identified molecular markers related to fruit browning, including CHO2a10, Hi22f04, CHO3bO1 and the like.
    At present, relevant records of related molecular markers about the ester flavour of apple fruits do not exist.
    Summary With respect to a defect that a period of screening new varieties of 'ester-type flavour’ fruits of apples is long, the present invention provides an SNP molecular marker for identification of genotypes enriched in ester components of apple fruits, so as to achieve an aim of providing a marker for molecular marker assisted breeding of 'ester-type flavour apples.
    The present invention further provides PCR primers amplifying the SNP molecular marker and an SNP gene chip containing the primers. According to the primers and the gene chip, 'ester-type flavour' apple individuals may be rapidly screened, and breeding efficiency is increased.
    The present invention further provides a method for rapidly identifying whether flavour of apple fruits is an 'ester-type flavour or not. The method is convenient in operation, high in efficiency and low in time consumption, and provides favourable technical support for quality breeding of the apple flavour.
    In the present invention, the apple F1 population of 'Starking' X 'Ralls' was established. The female cultivar 'Starking' whose fruits have high content of volatile esters, is a typical 'ester-type flavour’ apple variety. However, the male cultivar 'Ralls' is an 'aldehyde-type flavour’ variety of which fruits have low content of volatile esters and high content of volatile aldehydes and alcohols. The 233 individuals of this population and the restriction-site associated DNA sequencing (RAD-seq) technology are used to develop SNP markers and constructed a high-density genetic map. The composition and content of volatile components in fruits of various individuals in mapping population are further evaluated. By utilizing the constructed genetic linkage map and phenotypic evaluation results, quantitative trait loci (QTLs) location of the ester type components of the fruits in the population is conducted, and co-localized QTLs of different ester type components are identified, thereby obtaining a stable SNP genetic marker linked with the volatile esters. According to sequencing results of mapping population, the SNP genetic marker is confirmed as the #13133 base (plus strand) of contig of apple reference genome MDCO010190.184, that is, # 2249073 base in a plus strand direction of Chromosome 2, and is an A « G transformation type SNP, i.e., the SNP molecular marker for identification of ester-type volatile components of apple fruits in the present invention (called SNP molecular marker for short, similarly hereinafter) is located on the Chromosome 2 of the apple reference genome, and an A/G transformation type exists on the #2249073 base in the plus strand direction of the Chromosome 2 of the apple reference genome. According to phenotypic value evaluation results of the volatile components in fruits, the individuals showing heterozygous 'AG' genotype in position of #2249073 base of the Chromosome 2, whose fruits involve the higher content of 17 main volatile esters (such as 2-methyl butyl acetate, 2-methylbutyl acetate, (E)-2-hexenyl acetate, propyl acetate, butyl acetate, pentyl acetate, hexyl acetate, ethyl 2- methylbutyrate, butyl 2-methylbutyrate, 3-methyl-butyl propionate, butyl propionate, hexyl propionate, ethyl butyrate, propyl butyrate, butyl butyrate, ethyl hexanoate and hexyl hexanoate), which indicates that the fruit flavour of the individual carrying 'AG' genotype is 'ester-type'; however, when the allele position #2249073 of the Chromosome 2 exhibits homozygous 'AA', the individuals carrying this genotype, the fruits of these individuals are lower in content of the 17 main volatile esters, which indicates that the fruit flavour of progeny homozygous in this position is not the 'ester-type'. Therefore, by detecting the genotype at the #2249073 base, the fruit flavour type of the strain may be directly obtained from a molecular level.
    Further, in order to more conveniently acquire the genotype at the #2249073 base in an amplification method, a base sequence segment of respective 50bp bases at the upstream and downstream of a physical location of the base serves as the SNP molecular marker, and the base sequence of the SNP molecular marker is
    ATTTTAAGAAAACGATCGAGAATCATGAGTTATAGCTTATAGTTTATCTG AG AAATTGTGATTTTTGAGTTTTCTACGATTTTTTACGTACGTGAAAAAAAA, as shown in SEQ ID NO:1. An A/G transformation type single nucleotide polymorphism variant (A/G allele) exists at #51 base of the sequence, and is 51A or 51G.
    Further, the present invention further provides a PCR primer used for amplifying the SNP molecular marker for identification of the ester-type volatile components of apple fruits having the base sequence shown as SEQ ID NO:1. The primer may be used for specific PCR amplification of competitive alleles. The primer is as follows: an A allele primer (Primer Allele): 5' AATCGTAGAAAACTCAAAAATCACAATTTT 3', shown as SEQ ID NO:2; a G allele primer (Primer Allele): 5' CGTAGAAAACTCAAAAATCACAATTTC 3', shown as SEQ ID NO:3; and a common primer (Primer Common): 5' GAAAACGATCGAGAATCATGAGTTATAGCT 3', shown as SEQ ID NO:4.
    Further, fluorescence labels exist on the A allele primer and the G allele primer, but types of the fluorescence labels on the two primers are different. The fluorescence labels may be common fluorescence labels in the prior art, such as FAM fluorescence labels and HEX fluorescence labels.
    The present invention further provides an SNP gene chip for identification of the ester type volatile components of apple fruits (called SNP gene chip for short). The PCR primer of the SNP molecular marker for identification of the ester-type volatile components of apple fruits is fixed on the SNP gene chip, and the primer totally includes three types. By utilizing the SNP gene chip, rapid and accurate identification of the ester-type volatile components of apple fruits may be realized. The SNP molecular marker and the SNP gene chip in the present invention may be 5 applied to apple breeding for screening hybrid offspring individuals of apples having high content of the volatile esters in fruits. Due to use of the SNP molecular marker and the SNP gene chip, a novel method of molecular assisted breeding is provided, so that rapid screening of 'ester-type flavour’ new apple varieties is possible. Applications of the SNP molecular marker and the SNP gene chip for identification of the ester-type volatile components of apple fruits in the present invention in apple breeding are also in the protection scope.
    The present invention further provides a method for rapidly identifying ester-type volatile components of apple fruits. The method includes the following steps: (1) extracting apple genome DNA, taking the DNA as a template, and carrying out a competitive allele specific PCR reaction on the SNP gene chip for identification of the ester type volatile components of apple fruits; (2) analysing the SNP gene chip after PCR amplification is ended and judging the content of the ester type volatile components of apple fruits according to genotype of the SNP molecular marker.
    Further, procedures of the competitive allele specific PCR amplification (KASP amplification) are recorded in the prior art, and those skilled in the art may operate according to the prior art. In specific embodiments of the present invention, a used KASP amplification reaction system is 1 microliter, including 20 ng of template DNA, 0.14 microliter of a mixture of the 3 primers (the A allele primer, the G allele primer and the common primer), 0.5 microliter of Master mix (2x) (British LGC Company), and the balance of ddH2O, totalling 1 microliter. The procedures of the KASP amplification include: denaturation at 95°C for 15 min, 1 cycle; denaturation at 95°C for 20 s, annealing at 61°C for 60 s, 10 cycles, and reducing the annealing temperature by 0.6°C each cycle; and denaturation at 95°C for 20 s, annealing at 55°C for 60 s, 26 cycles.
    In the above method, the A allele primer serves as a primer for detecting A alleles, the G allele primer serves as a primer for detecting G alleles, and fluorescence labels respectively exist on the two primers. After PCR is ended, genotype of a detected sample is judged according to fluorescence signal intensity.
    In the above method, the chip is analysed after PCR amplification so as to obtain a genotype result of each individual. The content of the volatile esters in fruits is judged as follows: the content of the volatile esters in fruits of an AG genotype individual is more than an AA genotype individual. The objective variety may be selected according to the obtained genotype. The composition and content of the volatile components of the fruits of each individual in a mapping population are further evaluated. By utilizing the constructed genetic linkage map and phenotypic evaluation results, the quantitative trait loci (QTLs) of the ester-type components in fruits of the population are mapped. And co-localized QTLs for different ester-type components are identified, thereby obtaining a stable SNP genetic marker linked with the ester type volatile components.
    In the present invention, by identifying and screening a molecular marker in close linkage with genetic control loci of key smell components of the fruits and applying the molecular marker, types of smell flavour of seedling fruits may be identified by a molecular method, thereby realizing early selection of apple offsprings, greatly increasing breeding efficiency, shortening a breeding cycle and saving cost input of land and manpower.
    In the present invention, by utilizing a hybrid population constructed by an 'ester-type flavour’ apple cultivar 'Starking' an 'aldehyde-type flavour’ apple cultivar 'Ralls' and RAD sequencing, a high-density genetic map is constructed. An SNP (single nucleotide polymorphism) molecular marker in significant correlation to the ester-type volatile components of the apple fruits is obtained by mapping QTLs for the objective phenotype on the genetic map. And the involved primers and the SNP gene chip are developed according to the molecular marker, thereby realizing early identification of traits of the ester-type volatile components of the apple fruits. By virtue of the SNP molecular marker and the SNP gene chip in the present invention, rapid and accurate identification of the content of the ester-type volatile components of the apple fruits can be realized, and breeding time of 'ester-type flavour’ apples and economic cost are reduced. The present invention provides marker resources for molecular marker assisted breeding of apple flavour quality, lays a foundation for cultivating high-quality new germplasm by utilizing genetic engineering means, and has important theoretical significance and application values.
    Description of Drawings Fig. 1 is a 'Starking' X 'Ralls' genetic linkage map constructed in the present invention; Fig. 2 is a population frequency distribution diagram of phenotypes of 17 ester-type volatile components of the fruits determined by a test group in the present invention;
    Fig. 3 is mapping results of QTLs for phenotypes of 17 ester-type volatile components in fruits of the 'Starking' X 'Ralls' population on a linkage group 2 (LG2) in the present invention; in the map, ester components corresponding to English abbreviations are as follows: A2MP: 2-methyl butyl acetate, A2MB: 2-methylbutyl acetate, AE2H: (E)-2-hexenyl acetate, APR: propyl acetate, AB: butyl acetate, APE: pentyl acetate, AH: hexyl acetate, 2MBA: ethyl-2-methylbutyrate, 2MBB: butyl 2-methylbutyrate, PR3B: 3-methyl-butyl propionate, PRB: butyl propionate, PRH: hexyl propionate, BA: ethyl butyrate, BPR: propyl butyrate, BB: butyl butyrate, HA: ethyl hexanoate and HH: hexyl hexanoate; Fig. 4 is a sequence chart of physical position, and upstream and downstream of the linked SNP marker 'np2381' with ester-type volatile components of apple fruits in the present invention; Fig. 5 is a genotyping result transformation chart of a reaction signal by adopting SNPTyper after KASP detection of 88 offspring individuals in the 'Starking' X 'Ralls' population in the present invention; Fig. 6 is a heat map of detection results of 17 ester-type volatile components in fruits of 88 offspring individuals in the 'Starking' X 'Ralls' population in the present invention; content of specific components is subjected to logarithmic transformation according to a base of 10; the numerical value is from low to high and is represented by colours from light to dark; ester components corresponding to English abbreviations are as follows: A2MP: 2-methyl butyl acetate, A2MB: 2-methylbutyl acetate, AE2H: (E)-2-hexenyl acetate, APR: propyl acetate, AB: butyl acetate, APE: pentyl acetate, AH: hexyl acetate, 2MBA: ethyl-2-methylbutyrate, 2MBB: butyl 2-methylbutyrate, PR3B: 3-methyl-butyl propionate, PRB: butyl propionate, PRH: hexyl propionate, BA: ethyl butyrate, BPR: propyl butyrate, BB: butyl butyrate, HA: ethyl hexanoate and HH: hexyl hexanoate; codes on the right side of the diagram are numbers of strains; and Fig. 7 is a principal component analysis (PCA) diagram of 88 offspring individuals in a 'Starking' X 'Ralls' population based on 17 detected ester type volatile components of fruits by adopting the present invention.
    Detailed Description The present invention is further described below in combination with specific embodiments and drawings, so that those skilled in the art can clearly and completely understand technical solutions of the present invention. The following illustration is only exemplary and is not intended to limit the content.
    Embodiment 1 An SNP molecular marker for identification of ester-type volatile components in apple fruits in the present invention is obtained by adopting the following method:
    1. Used reagents and instruments Genome DNA (gDNA) of individuals in the test population is extracted by adopting a Plant Genomic DNA Kit (TIANGEN), and the kit is purchased from Tiangen Biotechnology (Beijing) Co., Ltd.; a restriction enzyme EcoR! is purchased from Sigma-Aldrich Company (USA); the needed reagents are treated after sample digestion: adapters , ATP, ligase, flat terminal enzymes and the like are purchased from Illumina Company (USA); and sequencing is performed by Beijing Novogene Bioinformation Technology Co., Ltd., and an llluminaHiseq 2500 sequencing platform (USA) is used in sequencing.
    2. SNP molecular marker acquisition method (1) Construction of 'Starking' X 'Ralls' genetic linkage map Including steps: taking an 'ester-type flavour apple variety 'Starking' having high content of volatile esters in the fruits as the female parent, taking an 'aldehyde-type flavour’ apple variety 'Ralls’ having low content of esters in the fruits and high content of aldehyde and alcohol volatiles as the male parent, taking their progeny as materials, and randomly selecting 223 individuals as a mapping population; performing whole genome DNA (gDNA) extraction on both parents and individuals by utilizing a plant genome DNA extraction kit (Plant Genomic DNA Kit); constructing sequencing libraries after DNA extraction, wherein operating steps are as follows: taking 500 ng of gDNA samples, and performing digestion by utilizing a restriction enzyme EcoRI; preheating the samples at 65°C for 20 min, adding 2 pL of 100 nM lllumina P1 adapters, simultaneously adding 1 HL of 100 nM rATP, 1 HL of 10xNEB buffer, 1 pL (1000 U) of T4 DNA ligase and 5 pL of H20O, and reacting at a normal temperature for 20 min; heating at 65°C for 20 min again, and performing ultrasonication to obtain fragments of about 500 bp averagely; and recovering fragments of 300-700bp by virtue of 1.5% agarose gel electrophoresis; treating the DNA samples by using a flat terminal enzyme; purifying the sample at 18°C, and adding adenine at 3' end of the DNA by utilizing 15U of Klenow exo; purifying the sample again, adding 1 uM of P2 adapters, and controlling a reaction temperature to 18°C; purifying again to obtain 50 pL of pure DNA; performing concentration determination on the purified samples, and performing PCR amplification; performing electrophoresis to recover fragments after amplification, and performing dilution for sequencing; and constructing RAD sequencing libraries, and performing sequencing by utilizing a
    Novogene llluminaHiseq 2500 sequencing platform, wherein a sequencing strategy adopts pair-end sequencing, and a sequencing length is 150 bp; performing RAD sequencing to obtain original data, and removing the adapters and low-quality sequences for marker development; distinguishing sequencing data of different individuals by utilizing sequencing labels, and performing cluster analysis on similar sequencing data; setting mismatch as 5 during clustering; discarding clusters of which the sequence support number is less than or equal to 2 or more than or equal to 100 (so as to ensure locus typing accuracy and prevent copy number variation); 5 sequence supports are needed at heterozygous loci at least, wherein a sequence support number of secondary bases is 3; deleting loci without polymorphism by virtue of locus information of both parents by utilizing Mendelian inheritance after SNP loci are obtained, and selecting loci having genotyping types of ImxIl, nnxnp and hkxhk; screening markers used for construction of the genetic map by the following conditions: the number of individuals without the markers is less than 45 (about 20% of the total population); due to chi-square test of the markers, the marker types of ImxIl and nnxnp accord with an expected segregation ratio of 1:1, the marker type of hkxhk accords with a segregation ratio of 1:2:1, and a significance level p of the chi-square test is less than 0.01; performing genetic linkage mapping on the screened labels by utilizing Joinmap 4.0 software (Van Ooijen, 2006), and setting a segmentation threshold as LOD=6; respectively constructing parent maps and an integration map by utilizing a regression algorithm; calculating genetic distances by utilizing a Kosambi's function, and increasing the markers in three rounds in sequence; and deleting linkage markers and multiple individuals while mapping, thereby ensuring that order of the markers in the maps is accurate.
    During linkage group segmentation, fifteen markers are deleted because they cannot be added into any linkage group. Further, by virtue of chi-square test of the segregation ratio, thirty markers are discarded due to segregation distortion. In mapping, 141 markers are deleted because they are not in close enough linkage with others in the same linkage group or their positions are unstable. In addition, due to too small amount of sequencing, seven individuals are deleted because over 20% of markers lack of genotyping data. Due to existence of a multiple recombination phenomenon, another thirteen individuals are also deleted.
    Finally, the drawn 'Starking' X 'Ralls’ integrated genetic linkage map is composed of 203 individuals and 5,053 markers (2,192 ImxIl markers, 2,318 nnxnp makers and 543 hkxhk markers) (as shown in Fig. 1). The markers are distributed in 17 linkage groups. According to physical positions of the markers corresponding to reference genome, the 17 linkage groups correspond to 17 chromosomes, and the number of markers, a genetic distance, marker density and other statistics corresponding to each linkage group are shown in Table 1. The number of markers in each linkage group is unequal from 229 to
    426. The total length of the integrated map is 1,400.13 cM, and the mean density is 0.28 cM per marker. Table 1 Linkage group Number of Genetic distance Average distance markers (cM) (cM) between markers
    66.53
    77.38
    85.24
    79.97
    97.35
    80.32
    90.62
    77.30
    76.39 LG10 78.61 LG11 88.36 LG12 81.11 LG13 79.28 LG14 70.97 LG15 127.84 LG16 68.32 LG17 75.54 5,053 1,400.13 (2) Evaluation of volatile components in fruits of mapping population and quantitative trait loci (QTLs) mapping Including steps: collecting mature fruits of 122 individuals of 'Starking’ X 'Ralls' population used for evaluating the volatile components in fruits in 2016; peeling, washing and chopping fresh fruits of each individual, accurately weighing 50 g of pulp for adding into a 100 mL of conical flask, adding 5 uL of 0.4 g-L! 3-nonanone as an internal standard substance, capping and sealing, and balancing the conical flask on a magnetic stirring heating plate at 50°C for 15 min; inserting a fibre extractor into a GC injection port at 250°C for 15 min; inserting the extractor into a balanced sample bottle to extract for 30 min, then inserting the extractor into the GC injection port again, desorbing at 250°C for 5 min, and performing gas chromatography-mass spectrometry (GC-MS) detection, wherein GC-MS determination is performed by adopting a Shimadzu GC/MS-QP2010 gas chromatography-mass spectrometer.
    Chromatographic conditions are as follows: Rtx- IMS (30 m X 0.25 mm X 0.25 um); an injection port temperature of 250°C; and programmed heating: maintaining an initial temperature of 35°C for 3 min, raising the temperature to 120°C at a rate of 5°C per min and maintaining the temperature for 1 min, continuously raising the temperature to 220°C at a rate of 10°C per min, and finally raising the temperature to 240°C at a rate of 20°C per min and maintaining the temperature for 5 min.
    Mass spectrometry conditions are as follows: carrier gas is helium, flow is 1.03 mL per min, electron impact (El) ionization is performed, electron energy is 70 eV, filament current is 0.25 mA; an ion source temperature is 250°C, a scanning mass range is 35-450 amu, and split sampling is not performed.
    Qualitative and quantitative identification of the volatile components are as follows: acquiring a total ion chromatogram by GC-MS analysis, enabling an unknown compound spectrogram to be matched with an NIST 08 spectral library by virtue of computer retrieval (only components having a matching degree greater than 80% are reported}, and combining with manual map analysis; solving relative content of each component according to a peak area normalization method, performing precise quantification by the 3-nonanone internal standard substance added in advance, wherein a calculation formula is as follows: content of specific components (ug:g')=peak area of specific components/peak area of the internal standard substance*concentration of the internal standard substance (g:L-)*5(uL)/sample amount (g"). The result is the mean value determined repeatedly by three times.
    The population frequency distribution diagrams of 17 main ester-type volatile components identified in the groups are obtained (Fig. 2). It can be seen that, various indexes show continuous variation, which indicates that quantitative traits subjected to multi-gene genetic control are in significant skewed distribution (Fig. 2), that is, main genetic loci exist, and determination results meet QTL mapping requirements.
    By utilizing the genetic linkage map and phenotypic evaluation results of the 17 volatile esters in fruits of the mapping population, QTL mapping is performed.
    The QTLs are detected by interval mapping by utilizing software MapQTL6.0 (Van Ooijen, 2009), and the algorithm model adopts a mixed model.
    A significance threshold of the QTLs in a whole genome scope is LOD=3.0, p<0.05. The marker located on a LOD peak is a marker in close linkage with the loci.
    One QTL hot region (0-6.9 cM) co-localized to the top of the linkage group 2 (LG2) is identified, and the region is related to all the 17 detected ester type volatile components, and the LOD peak markers of the components are all 'np2381', so that the marker is confirmed as a molecular marker in close linkage with phenotypes of the ester-type volatile components in apple fruits (as shown in Fig. 3). Related QTL genetic intervals in the hot genetic control region, LOD values, LOD peak markers and explanations of phenotypic variation rates of the 17 components are exhibited (Table 2). Table 2 Ester type Genetic LOD LOD peak Explained components interval (cM) marker variation rate pm er] "| | 2-methyl butyl LG2: 0-6.6 np2381 36.75 Ne Acetic acid-2- LG2: 0-5.1 5.99 np2381 31.82 Er Acetic acid-(E)-2- | LG2: 0-5.9 6.10 np2381 35.07 eenen Ethyl-2- LG2: 0-4.9 4.65 np2381 22.71 mese Butyl 2- LG2: 0-5.1 4.70 np2381 22.72 mare | 3-methyl-butyl LG2: 0-6.1 6.25 np2381 35.75 ee an | eee |E | Feolheranode 162043] 608 | wal | 3505 (3) Application of SNP marker in linkage with phenotypes of ester-type volatile components in apple fruits
    According to sequencing results of individuals, confirming that the SNP marker 'np2381' corresponds to the #2249073 base in plus strand direction of Chromosome 2 in apple genome, and the marker is of an A<>G transformation type SNP (as shown in Fig. 4), that is, the #2249073 base is an A/G allele.
    According to the physical position of the apple genome corresponding to the linked SNP, respective 50 bp bases at the upstream and downstream of the physical location of the marker are downloaded (as shown in Fig. 4) as the SNP molecular marker, and the sequence of the molecular marker is shown as SEQ ID NO:1. Meanwhile, a PCR primer amplifying the SNP molecular marker by adopting competitive allele specific PCR (KASP) is designed. The sequences are as follows: an A allele primer (Primer Allele FAM): 5' GAAGGTGACCAAGTTCATGCTAATCGTAGAAAACTCAAAAATCACAATTTT 3, shown as SEQ ID NO:2; a G allele primer (Primer Allele HEX): 5 GAAGGTCGGAGTCAACGGATTCGTAGAAAACTCAAAAATCACAATTTC 3 shown as SEQ ID NO:3; and a common primer (Primer Common): 5' GAAAACGATCGAGAATCATGAGTTATAGCT 3', shown as SEQ ID NO:4. Embodiment 2 To efficiently, rapidly and accurately detect the SNP molecular marker in the present invention, the SNP molecular marker can be made into an SNP gene chip. PCR primers amplifying the molecular marker are fixed on the SNP gene chip. The gene chip is made by Affymetrix Company (USA). Genome DNA of test population is extracted; a KASP reaction is carried out on the SNP gene chip involved the primes related to the SNP molecular marker; and the content of ester type volatile components of fruits in the test group is rapidly identified by virtue of genotype of the SNP molecular marker. Specific operations are as follows: collecting young leaves of 88 individuals of 'Starking' X 'Ralls' mapping population, extracting genome DNA of the test group and varieties by adopting a Plant Genomic DNA Kit (Beijing TIANGEN Company), and carrying out a KASP reaction on the made SNP gene chip, wherein the KASP amplification reaction system is totally 1 microliter, including 20 ng of template DNA, 0.14 pL of a mixture of the 3 primers (the A allele primer, the G allele primer and the common primer), 0.5 pL of Master mix (2x) (British LGC Company), and the balance of ddH2O, totalling 1 HL; injecting the prepared reaction system into the gene chip by a pipettor, and sealing the inlet/outlet; placing the gene chip on a centrifugal bracket, centrifuging at a centrifugal speed of 3,000 rpm for 1 min, performing uniform centrifugation, and distributing to reaction holes; then, placing the gene chip on a plate PCR instrument (made by Beijing CapitalBio Co., Ltd.) for performing amplification, and running amplification procedures as follows: denaturation at 95°C for 15 min, 1 cycle; denaturation at 95°C for 20 s, annealing at 61°C for 60 s, 10 cycles, and reducing the annealing temperature by 0.6°C in each cycle; and denaturation at 95°C for 20 s, annealing at 55°C for 60 s, 26 cycles; after running completion of the PCR amplification procedures, putting the gene chip into a GeeDom LuxScan 10K/D microarray chip scanner (made by Beijing CapitalBio Co.
    Ltd.) for performing scanning, converting the collected fluorescence signal into a digital signal, and generating original data of the gene chip; and performing typing by virtue of typing software SNPTyper, and determining the content of the ester-type volatile components in the fruits of each individual in the test population according to genotyping results.
    Fig. 5 shows a genotyping result transformation of a KASP reaction signal by adopting the SNPTyper, and two genotyping groups are obtained, that is, AA and AG, which indicates that the 88 individuals participating in test may be divided into the above two genotypes; determining their phenotypes (17 ester- type volatile components in fruits) corresponding to the genotyping results of the marker, and verifying genotyping results of the test group, wherein phenotype detection results of the 88 individuals are shown in Fig. 8; a content heat map of the 17 ester type volatile components in fruits of the 88 individuals is shown in the figure, and the content is represented by colours from light to dark, which indicates that the group composed of the 88 individuals may be clearly divided into two parts, that is, a light-colour individual with low content of the volatile esters and a dark-colour individual with high content of the volatile esters; the two phenotype groups are consistent with the genotype grouping results shown in Fig. 5, wherein the content of ester-type components in fruits of an AA individual of a homozygous genotype is low, while content of ester-type components in fruits of an AG individual of a heterozygous genotype is high; further performing principal component analysis on the test group according to the content of the ester-type volatiles in fruits of the 88 individuals.
    The results are shown in Fig. 7, which indicates that the test group composed of the 88 individuals can also be divided into two groups, corresponding to genotyping results in Fig. 5. According to the above results, it can be seen that, by virtue of detection of corresponding genotypes, the content of the ester-type volatile components in the fruits can be judged by adopting the gene chip developed by the molecular marker.
    Thus, it can be seen that, by adopting the genotyping results of the test group by the molecular marker in the present invention, rapid and accurate identification of the content of the ester type components in the fruits of a hybrid population is realized; early judgment about whether the fruits are of an 'ester-type flavour or not is further realized; and breeding time of excellent flavour varieties of apples and economic cost are reduced.
    The present invention provides valuable molecular marker for marker-assisted breeding of 'ester-type flavour’ apples, lays a foundation for innovating new germplasm of excellent flavour apples by utilizing genetic engineering means and has important theoretical significance and application values.
    权利要求:
    Claims (1)
    [1]
    CONCLUSIONS
    An SNP molecular marker for identifying the property of ester-type volatile constituents in apple fruits, located on chromosome of the apple reference genome, where there exists an A / G allele at base # 2249073 in a plus strand of chromosome 2 of the apple reference genome.
    The SNP molecular tag of claim 1, wherein a base sequence of the molecular tag is shown as SEQ ID No. 1, and an A / G transformation type single nucleotide polymorphism variant exists at base # 51 of the base sequence containing 51A or 51G is.
    A PCT primer for amplifying the SNP molecular tag for identification of ester-type volatiles in apple fruits according to claim 2, comprising: an A allele primer: 5 'AATCGTAGAAAACTCAAAAATCACAATTTT 3' (SEQ ID No. 2) ; a G allele primer: CGTAGAAAACTCAAAAATCACAATTTC 3 '(SEQ ID NO. 3); and a common primer: 5 ° GAAAACGATCGAGAATCATGAGTTATAGCT 3 (SEQ ID NO 4).
    The PCT primer of claim 3, wherein fluorescence markers are present on the A allele primer and the G allele primer, the fluorescence markers being different on the two primers.
    An SNP gene chip for identification of ester-type volatile components in apple fruits, wherein the PCT primer for the SNP molecular marker for identification of ester-type volatile components in apple fruits according to claim 3 or 4 is on the SNP gene. chip is secured.
    Use of the SNP molecular marker for identification of ester-type volatile components in apple fruits according to claim 1 or 2 and the SNP gene chip for identification of ester-type volatile components in apple fruits according to claim 5 in apple breeding.
    The use of claim 6, wherein the SNP molecular marker for identification of ester-type volatile components in apple fruits and the SNP gene chip for identification of ester-type volatile components in apple fruits are used for screening individual hybrid progeny of 'ester' type apples.
    A method for rapidly identifying ester-type volatile constituent properties in apple fruits, the method comprising the steps of: (1) extracting genomic DNA from the apple, taking DNA as a template and performing the following steps: a competitive allele-specific PCR reaction on the SNP gene chip for identification of ester-type volatile components in apple fruits according to claim 5; (2) analyzing the SNP gene chip after the completion of the PCR amplification and evaluating the content of the ester-type volatile components in the apple fruits according to a genotype of the SNP molecular marker.
    The method of claim 8, wherein a relationship between the content of the ester-type volatile components in the apple fruits and the genotype is as follows: AG genotype> AA genotype.
    类似技术:
    公开号 | 公开日 | 专利标题
    US10550424B2|2020-02-04|Methods for sequence-directed molecular breeding
    CN103555717B|2015-06-10|Functional molecular markers of related genes of sweetness and sourness characters of muskmelon and application of markers
    CN108004344A|2018-05-08|A kind of corn whole genome SNP chip and its application
    CN102159711A|2011-08-17|Method for diagnostic marker development
    CN105925721A|2016-09-07|Single nucleotide polymorphism marker site, primer and kit for identifying coloring property of peach epidermis and application
    Eduardo et al.2014|Development of diagnostic markers for selection of the subacid trait in peach
    Zheng et al.2013|A consensus linkage map of common carp | to compare the distribution and variation of QTLs associated with growth traits
    CN113151561A|2021-07-23|Molecular marker BnC04Y2498 for identifying dwarf cabbage type rape and application thereof
    CN110894542A|2020-03-20|Primer for identifying types of GS5 gene and GLW7 gene of rice and application of primer
    CN110747288A|2020-02-04|Rice large grain gene function marker and application
    NL2025233B1|2021-08-23|Snp molecular marker for &#39;ester-type flavour&#39; trait identification of apple fruits as well as primers and applications thereof
    CN111088389B|2022-02-01|SSR molecular marker closely linked to corn leaf width as well as amplification primer and application thereof
    CN112575116A|2021-03-30|Soybean whole genome SNP locus combination, gene chip and application
    US11154024B2|2021-10-26|Single nucleotide polymorphism | markers for Phaseolus vulgaris L. and methods of use thereof in selection efficiency with breeding strategies
    CN107760798B|2020-10-23|SSR molecular marker of seedless major QTL | of grape fruit
    CN107937591B|2021-04-13|SNP marker of QTL site related to low-temperature saccharification resistance at tail end of potato chromosome XI and application of SNP marker
    CN106755413B|2020-07-07|Rice nitrogen absorption and utilization site qNUE6 and molecular marking method thereof
    US20110010102A1|2011-01-13|Methods and Systems for Sequence-Directed Molecular Breeding
    Nybom et al.2008|Self-incompatibility alleles of 104 apple cultivars grown in northern Europe
    CN113278723B|2021-11-26|Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application
    CN110512024B|2022-03-18|SNP molecular marker related to low acidity or acidity state of peach fruit and application thereof
    US10172305B2|2019-01-08|Diagnostic molecular markers for seed lot purity traits in soybeans
    CN107287210B|2020-10-09|Rice appearance quality gene qAQ7 and molecular marking method and application thereof
    CN108823330B|2022-01-14|Soybean HRM-SNP molecular marker point marking method and application thereof
    Wu et al.2013|Genome mapping, markers and QTLs
    同族专利:
    公开号 | 公开日
    CN110055350A|2019-07-26|
    NL2025233B1|2021-08-23|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    优先权:
    申请号 | 申请日 | 专利标题
    CN201910451729.3A|CN110055350A|2019-05-28|2019-05-28|A kind of SNP marker, primer and its application of Apple " ester odor type " Characters Identification|
    [返回顶部]